Rv6006 (tRNA-Met7)


Species:	M. tuberculosis
Strain:	H37Rv
PATRIC Annotation:	tRNA-Met
Synonyms:
M. smegmatis homologs
M. abscessus homologs
Gene Start:	731606
Gene End:	731682
Vulnerability Index (VI):
VI Lower Bound:
VI Upper Bound:

[AlphaFold] [Orthologs] [Phyre2] [UniProt] [MycoBrowser] [U19] [TnSeq DB]

Essentiality:

Call	Condition	Type	Source	Notes
Unknown	in vitro	TnSeq	[DeJesus et al. (2017)]
Unknown	in vitro	CRISPRi	[Bosch & DeJesus et al. (2021)]

DNA Sequence help

GTACGACGAGTTCAGCGGGGCGGAGCCGCGACACAGGGTGCCAATCTTGGACGACTTGGTCCGTAGCTGCATGGGTGGCACCGGTGGTTTGGTGGCGTTGCGCGCCAGGCTGTACCCTCTTTTAGGCCCGCGGCACGACCCGACTGGTCGCTACGGGTGAGCGGCCCCCTTAGCTCAGTCGGCAGAGCGGGTAAGGAAAAGGTCAACGGTTCGTAGGGGGCTCGGCGGACGCCGGGCAGGCTGGCGGTGCGTACCAGAGGCGATGTAGCTCAGTCGGTTAGAGCGAACGACTCATAATCGTTAGGTCGCCGGTTCGAGTCCGGCCATCGCTACAA

Gene not present in the RLC0012 CRISPRi library.

Specific References

General References

Sassetti CM, Boyd DH, Rubin EJ. (2003). Genes required for mycobacterial growth defined by high density mutagenesis. Mol Microbiol.
Fol M, Chauhan A, Nair NK, Maloney E, Moomey M, Jagannath C, Madiraju MV, Rajagopalan M. (2006). Modulation of Mycobacterium tuberculosis proliferation by MtrA, an essential two-component response regulator. Mol Microbiol.
Griffin JE, Gawronski JD, Dejesus MA, Ioerger TR, Akerley BJ, Sassetti CM. (2011). High-resolution phenotypic profiling defines genes essential for mycobacterial growth and cholesterol catabolism. PLoS Pathogens.
Zhang YJ, Reddy MC, Ioerger TR, Rothchild AC, Dartois V, Schuster BM, Trauner A, Wallis D, Galaviz S, Huttenhower C, Sacchettini JC, Behar SM, Rubin EJ. (2013). Tryptophan biosynthesis protects mycobacteria from CD4 T-cell-mediated killing. Cell.
DeJesus MA, Gerrick ER, Xu W, Park SW, Long JE, Boutte CC, Rubin EJ, Schnappinger D, Ehrt S. (2017). Comprehensive essentiality analysis of the Mycobacterium tuberculosis genome via saturating transposon mutagenesis. MBio.