Ms4133 (MSMEG4133)

Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa494110410>>.
Could not find gene with ID = 'MSMEG1717' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa4a0129910>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa4878cd850>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa48733c080>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa46d963260>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa48e01b200>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa494110bf0>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa49424f9b0>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa446717380>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa48e7514c0>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa4878cd700>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa4467172f0>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa446716a20>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa48e038860>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa49424e2d0>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa46d9623f0>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa446716a20>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa446714b60>>.
Could not find gene with ID = 'MSMEG4958' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa48e03a420>>.
Could not find gene with ID = 'MSMEG1254' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4261' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa49441da60>>.
Could not find gene with ID = 'MSMEG1103' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa4a0d56d20>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa49c352ae0>>.
Could not find gene with ID = 'MSMEG3854' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa48e753d70>>.
Could not find gene with ID = 'MSMEG4191' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1451' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa4a0936ed0>>.
Could not find gene with ID = 'MSMEG5816' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa48733c770>>.
Could not find gene with ID = 'MSMEG6354' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa446717680>>.
Could not find gene with ID = 'MSMEG5726' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2239' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2462' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6588' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5168' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3508' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2781' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1212' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa494591eb0>>.
Could not find gene with ID = 'MSMEG5483' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3641' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6278' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5917' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa4945926f0>>.
Could not find gene with ID = 'MSMEG1661' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1993' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3627' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0298' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1510' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3911' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4851' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1214' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5238' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1914' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1262' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6122' and Strain = 'H37Rv'

MSMEG4133

ms4133

M. smegmatis · MC2-155

[AlphaFold] [Orthologs] [Phyre2] [UniProt] [MycoBrowser] [TnSeq DB] [SeqHub]

MC2-155 Coordinates:	4212793 – 4213806
Vulnerability Index (VI):
M. tuberculosis homologs	Rv3430c
M. abscessus homologs

DNA and Protein Sequence help

DNA Sequence

>ms4133_MSMEG4133_dna

GCCTGTACGACCAACGATGGTGGGGCGTACCTGCGCGTTGAGGGGTTGTCAGATCGCCGAGTGGCGCAAACAACGCGGGTGTTGGAAGGCAAGGCACCTGGGGAGAAGGTCGGTAAACTCACCCGCGAGCAGGCCGAGATCGCCCGCCTGAAAAAGGAACTCGCCCAGGCCAATAATCGGCTGGCGACCACCGAGGGGGGATCATGGGAAAAGCACACGCGCTCTTGGAGTCTCTCTCCGAGAGCGCGGACACCGACACGCCGCCGACCAAGCGCTGATGGCAACGATCTGCGGGATATCCAGCCCGCAAGGCCGCGGAGGTGACCGGCATGCACCGCTCGACGGCCACTCGACGCGCCAAACCCGCGCCGGCGCTCGGGCACCACGACCGTCAACAAGCTCACCGAGTCCGAATGCACCCGGGTGGTTGAGACAGTTCGTCGGCCGATGCAGGTGTGGGCCACGATGAAGGCAGCTACCTGTGTTCGGTGTCGACGATGTACCGCCAAGCTGGTCAAGGAGCGCCGTCGGCTGGCCCGGCACCGCAAAGCGGTGAACTGGTGGCCACCGCGCCGCGGCAGGTGTATTCGTGGGACATCACCAAACTGGCCGGCCCGGTCAAAGGGGTCTACTACGACGCCTACGTGATGATCGACATTCACTCGCGTTACATCGTCGGGGTCCATGTGCACGCCCGCGAATGCGGCCAGCTGGCCAAGGAGATGATGGAACAGATCTTCGGCACCTACGGCACGTCGTGCACGCTGATCGGGGCACCTCGATGACCAGCAACACCGTCGCCGGACGGATCTGGGCGTCATCCGCTCGCATTCGCGGCCCAAGGTATCCAACGACAACCCCTACAGCGATTCAAGACCTTGAAGTATGCGCCGGCAACGCTTCGAATCCATCCATCACGCGAGGGATTTCATGGACCGATTCGTGCAGTGGTACAACCATGAACACCGCCACAGCGGCATCGGGCTGCACACACCCGCCGATGTGGCCTCGCCGGCGGGAAAGACACCCAGCGCCGAGCCCCGACGCCAGGGCGCGCCACCCACGCCGATTCGGCCGCGACACCGCACCCAAGGTCATCGACCTACCTGAATCCGCGGCGATCAACCCACCCAAACCGGCCGAACAGGAGACCGAAACGGAAGCCGCTTAA

Protein Sequence

>Ms4133_MSMEG4133_protein

MDAYNDLRDIQIPTRKAAEVTGMHRSTATRRAKPAPAPADRAPRPVPVNKLTESECTRVVEVLNSARFVDAAPMQVWATLLDEGSYLCSVSTMYRVLNANKLVKERRRLARHRKAVCPELVATAPRQVYSWDITKLAGPVKGVYYDAYVMIDIHSRYIVGVHVHARECGQLAKEMMEQIFGTYGIPHVVHADRGTSMTSNTVAGLLSDLGVIRSHSRPKVSNDNPYSESWFKTLKYAPAFPERFESIHHARDFMDRFVQWYNHEHRHSGIGLHTPADVFYGLAGGKDTQRRAVLADARARHPRRFGRDTAPKVIDLPESAAINPPKPAEQETETEAA

Essentiality:

Call	Condition	Type	Source	Notes
Unknown	in vitro	CRISPRi	[Bosch & DeJesus et al. (2021)]
Non Essential	in vitro	TnSeq	[Dragset et al. (2019)]

You do not have permission to view notes.