ML0425
mL0425
Possible conserved membrane protein
M. leprae · TN
[TnSeq DB] [SeqHub]
TN Coordinates: 524417 – 524644
Vulnerability Index (VI):
Click the tabs above to view different types of data for this gene. The Vulnerability tab shows CRISPRi fitness data.
DNA and Protein Sequence help

DNA Sequence 

>mL0425_ML0425_dna
TGGCGGACCGGCATCCAGACACCATAAAGCTGGAGATTGACGTTGCCCGTGAACAGTTCGCGGCGACCGTCGACTCACTTGCTGAGCGTGCCAATCCCCGCCGTCTCGCCGGTGATCTCAAGGCCCGGGTGGTAGAGTTTGGGAGAAGGCCGGCGGTGATCGCCGCGCTGGTAAGTTGTGCAGTTTTGACCGTGATAGTTGTGGTACGCAAGGTCAAGAATCGCTGAA

Protein Sequence 

>ML0425_ML0425_protein
WRTGIQTP_SWRLTLPVNSSRRPSTHLLSVPIPAVSPVISRPGW_SLGEGRR_SPRW_VVQF_P__LWYARSRIAE

No essentiality data available for this gene.

AlphaFold Protein Interactions

Protein–protein interactions (PPIs) were predicted by co-folding ML0425 with every other protein in the M. leprae proteome using a pooled-AlphaFold3 based approach (Horia et al.). The size-corrected interface predicted template modeling (sciPTM) score indicates confidence in the predicted interaction: weak evidence (sciPTM > 0.05), intermediate evidence (sciPTM > 0.2), or strong evidence (sciPTM > 0.4).

0 proteins show strong predicted evidence for PPIs

3 show intermediate predicted evidence for PPIs

32 show weak predicted evidence for PPIs

View all pooled AlphaFold results for ML0425

Use of these data is subject to the AlphaFold Server Output Terms of Use.

You do not have permission to view notes.