ML0675
mL0675
Probable integral membrane protein
M. leprae · TN
[TnSeq DB] [SeqHub]
TN Coordinates: 811544 – 811819
Vulnerability Index (VI):
Click the tabs above to view different types of data for this gene. The Vulnerability tab shows CRISPRi fitness data.
DNA and Protein Sequence help

DNA Sequence 

>mL0675_ML0675_dna
TGCGTGCAGCGTTGCGGTCGCAATGGCCGATTCTGCTGGTTGGGATGATCTTCGCTGGAGCGTTCGTGCTGGTGGGGGCAAATTTTTGGCGTCGTGGTGCGCTACTAATCGGTATCGGTGTCGGGGTAGCAACAGTGCTGCGACTGGTGTTATCCGATGAGCGGGCTGGCCTGTTGATGGTGCGCGGCAAGGTCATCGACTTGGTTACAACGGCGTTAGTCGGTATGGCGATGGTCTACATCGCGTCGACCATCGACCCGCTAGGCACCGGCTAGA

Protein Sequence 

>ML0675_ML0675_protein
CVQRCGRNGRFCWLG_SSLERSCWWGQIFGVVVRY_SVSVSG_QQCCDWCYPMSGLAC_WCAARSSTWLQRR_SVWRWSTSRRPSTR_APAR

No essentiality data available for this gene.

AlphaFold Protein Interactions

Protein–protein interactions (PPIs) were predicted by co-folding ML0675 with every other protein in the M. leprae proteome using a pooled-AlphaFold3 based approach (Horia et al.). The size-corrected interface predicted template modeling (sciPTM) score indicates confidence in the predicted interaction: weak evidence (sciPTM > 0.05), intermediate evidence (sciPTM > 0.2), or strong evidence (sciPTM > 0.4).

1 protein shows strong predicted evidence for PPIs

8 show intermediate predicted evidence for PPIs

90 show weak predicted evidence for PPIs

View all pooled AlphaFold results for ML0675

Use of these data is subject to the AlphaFold Server Output Terms of Use.

You do not have permission to view notes.