ML1294c
mL1294c
conserved hypothetical protein
M. leprae · TN
[TnSeq DB] [SeqHub]
TN Coordinates: 1544359 – 1544613
Vulnerability Index (VI):
Click the tabs above to view different types of data for this gene. The Vulnerability tab shows CRISPRi fitness data.
DNA and Protein Sequence help

DNA Sequence 

>mL1294c_ML1294c_dna
CACGTTGAGCAACCGACTGGCGCCACCGCGGAGCCGGCTACCCGCCGGTTGGGACGCTGAGATGTCTAACGAGTACGAATGGGTGCCGTTGCACCTGCCGTCAGAATTGACCACGCTTAACGCATCGACCCGGCTGTCCATCGAGGCTGAATATTGCGGTTGGGAGCTGATCAAGGTGCGGATCTACACCGACGGCAGTAGGAGGACATTGTTGCGCCGCAATAACTCTCGTCTAGAAAACACAGGCTCCGACCG

Protein Sequence 

>ML1294c_ML1294c_protein
HVEQPTGATAEPATRRLGR_DV_RVRMGAVAPAVRIDHA_RIDPAVHRG_ILRLGADQGADLHRRQ_EDIVAPQ_LSSRKHRLRP

No essentiality data available for this gene.

AlphaFold Protein Interactions

Protein–protein interactions (PPIs) were predicted by co-folding ML1294c with every other protein in the M. leprae proteome using a pooled-AlphaFold3 based approach (Horia et al.). The size-corrected interface predicted template modeling (sciPTM) score indicates confidence in the predicted interaction: weak evidence (sciPTM > 0.05), intermediate evidence (sciPTM > 0.2), or strong evidence (sciPTM > 0.4).

0 proteins show strong predicted evidence for PPIs

10 show intermediate predicted evidence for PPIs

46 show weak predicted evidence for PPIs

View all pooled AlphaFold results for ML1294c

Use of these data is subject to the AlphaFold Server Output Terms of Use.

You do not have permission to view notes.