ML1343c
mL1343c
Possible exported alanine and valine rich protein (pseudogene)
M. leprae · TN
TN Coordinates: 1600581 – 1600662
Vulnerability Index (VI):
Click the tabs above to view different types of data for this gene. The Vulnerability tab shows CRISPRi fitness data.
DNA and Protein Sequence help

DNA Sequence

>mL1343c_ML1343c_dna
TATTTGGGACGCCTATCGCGATCCGATGTCCAACGTCATACTGCTGGACAAGAAGACGAGCCAGCATCTTGCGCAATGGAAT

Protein Sequence

>ML1343c_ML1343c_protein

No essentiality data available for this gene.

You do not have permission to view notes.