ML1357
mL1357
conserved hypothetical protein
M. leprae · TN
[TnSeq DB] [SeqHub]
TN Coordinates: 1617920 – 1618105
Vulnerability Index (VI):
Click the tabs above to view different types of data for this gene. The Vulnerability tab shows CRISPRi fitness data.
DNA and Protein Sequence help

DNA Sequence 

>mL1357_ML1357_dna
CTATCGATCCTGATCAGATTCGCGCCGAAATCGATGCCCTGCTTGCCCAGCTGCCTGACTTCGCCGACTTAGAAGACTCGGTAAGCGGGCTATCTCTTGCCCAGCTCGAAGAGGTAGCGCTCCGTTTTTCCGAGGTGCATTCCGTGCTGTTGCAGGCTCTAGAGTCAGCGGAGAAGGGTTGACTGC

Protein Sequence 

>ML1357_ML1357_protein
LSILIRFAPKSMPCLPSCLTSPT_KTR_AGYLLPSSKR_RSVFPRCIPCCCRL_SQRRRVDC

No essentiality data available for this gene.

AlphaFold Protein Interactions

Protein–protein interactions (PPIs) were predicted by co-folding ML1357 with every other protein in the M. leprae proteome using a pooled-AlphaFold3 based approach (Horia et al.). The size-corrected interface predicted template modeling (sciPTM) score indicates confidence in the predicted interaction: weak evidence (sciPTM > 0.05), intermediate evidence (sciPTM > 0.2), or strong evidence (sciPTM > 0.4).

1 protein shows strong predicted evidence for PPIs

6 show intermediate predicted evidence for PPIs

37 show weak predicted evidence for PPIs

View all pooled AlphaFold results for ML1357

Use of these data is subject to the AlphaFold Server Output Terms of Use.

You do not have permission to view notes.