ML1911Ac
mL1911Ac
conserved hypothetical protein
M. leprae · TN
TN Coordinates: 2295163 – 2295378
Vulnerability Index (VI):
Click the tabs above to view different types of data for this gene. The Vulnerability tab shows CRISPRi fitness data.
DNA and Protein Sequence help

DNA Sequence

>mL1911Ac_ML1911Ac_dna
TTGGCCCATGCTGAAGAAGGTCGAGATAGAGGTTGACGACGACCTAGTCCAAGAGGTCATACGCCGGTACGGGTTATTGGGCAGGCGAGAGGCCGTCCATCTGGCGCTCAAGGCTCTCCTTGGCGAACCCGGTGTCGGGGGCCTCTCAGAACAGGACCCAGAATATGACGAGTTCAGCAACCCTGATGCGTGGCGTACACGCCGAAGCAGCGACAC

Protein Sequence

>ML1911Ac_ML1911Ac_protein
LAHAEEGRDRG_RRPSPRGHTPVRVIGQARGRPSGAQGSPWRTRCRGPLRTGPRI_RVQQP_CVAYTPKQRH

No essentiality data available for this gene.

AlphaFold Protein Interactions

Protein–protein interactions (PPIs) were predicted by co-folding ML1911Ac with every other protein in the M. leprae proteome using a pooled-AlphaFold3 based approach (Horia et al.). The size-corrected interface predicted template modeling (sciPTM) score indicates confidence in the predicted interaction: weak evidence (sciPTM > 0.05), intermediate evidence (sciPTM > 0.2), or strong evidence (sciPTM > 0.4).

0 proteins show strong predicted evidence for PPIs

2 show intermediate predicted evidence for PPIs

24 show weak predicted evidence for PPIs

View all pooled AlphaFold results for ML1911Ac

You do not have permission to view notes.