ML1972c
mL1972c
hypothetical protein
M. leprae · TN
TN Coordinates: 2356318 – 2356548
Vulnerability Index (VI):
Click the tabs above to view different types of data for this gene. The Vulnerability tab shows CRISPRi fitness data.
DNA and Protein Sequence help

DNA Sequence

>mL1972c_ML1972c_dna
CACTTGCTTGCCGAGCAGGAACCGCGATGCCAATGTGGTTGACCTGACCGACTCGCACTCCCGCGAAGCGTTCTTCAACGAAGCACTGGGCGGCGCTACGAAAGTGTTGGTGATGATCACCGAGGGTCTGGTTATGTACCTCGATGACCGTGACGTCATCCTTTTATCTGAGGTGATTACACGATCCGAAGTCACCTGGTGGGTGCTCGATTTAGCCGGCCCAGGCCTCAA

Protein Sequence

>ML1972c_ML1972c_protein
HLLAEQEPRCQCG_PDRLALPRSVLQRSTGRRYESVGDDHRGSGYVPR_P_RHPFI_GDYTIRSHLVGARFSRPRPQ

No essentiality data available for this gene.

AlphaFold Protein Interactions

Protein–protein interactions (PPIs) were predicted by co-folding ML1972c with every other protein in the M. leprae proteome using a pooled-AlphaFold3 based approach (Horia et al.). The size-corrected interface predicted template modeling (sciPTM) score indicates confidence in the predicted interaction: weak evidence (sciPTM > 0.05), intermediate evidence (sciPTM > 0.2), or strong evidence (sciPTM > 0.4).

4 proteins show strong predicted evidence for PPIs

6 show intermediate predicted evidence for PPIs

33 show weak predicted evidence for PPIs

View all pooled AlphaFold results for ML1972c

You do not have permission to view notes.