ML1995
mL1995
conserved hypothetical protein
M. leprae · TN
[TnSeq DB] [SeqHub]
TN Coordinates: 2383094 – 2383330
Vulnerability Index (VI):
Click the tabs above to view different types of data for this gene. The Vulnerability tab shows CRISPRi fitness data.
DNA and Protein Sequence help

DNA Sequence 

>mL1995_ML1995_dna
AGACAGCACGGGAAAGGATTCTCACGGCTGTCTGTGAGGTGTTGTACATAGCAGAATCAGATTTGGTTGACGGCGATGAAACCGATCTTCGCGACCTCGGGCTAGACTCTGTTCGGTTCACGCTCTTAATGAAGCAACTCGGTCTGAGCCAAGAAGCTGAGATGCAATCCAAATTGATGGACAATTTTTCGATTGCAAACTGGGTTCGCCAGCTGGAGAGTTCTACGTGACGGCGCC

Protein Sequence 

>ML1995_ML1995_protein
RQHGKGFSRLSVRCCT_QNQIWLTAMKPIFATSG_TLFGSRS__SNSV_AKKLRCNPN_WTIFRLQTGFASWRVLRDGA

No essentiality data available for this gene.

AlphaFold Protein Interactions

Protein–protein interactions (PPIs) were predicted by co-folding ML1995 with every other protein in the M. leprae proteome using a pooled-AlphaFold3 based approach (Horia et al.). The size-corrected interface predicted template modeling (sciPTM) score indicates confidence in the predicted interaction: weak evidence (sciPTM > 0.05), intermediate evidence (sciPTM > 0.2), or strong evidence (sciPTM > 0.4).

3 proteins show strong predicted evidence for PPIs

2 show intermediate predicted evidence for PPIs

19 show weak predicted evidence for PPIs

View all pooled AlphaFold results for ML1995

Use of these data is subject to the AlphaFold Server Output Terms of Use.

You do not have permission to view notes.