Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x778490b51070>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x77849177c890>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x77849171eea0>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7784907d8320>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x778490bb9520>>.
Could not find gene with ID = 'MSMEG3181' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3181' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4448' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4448' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x77849030a300>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x778490bb91c0>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7784913e50d0>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7784913b78f0>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x778490309550>>.

MSMEG1795 (MSMEG1795)


Species:	M. smegmatis
Strain:	MC2-155
PATRIC Annotation:	-
Synonyms:
M. tuberculosis homologs	adhE1, adhA, RVBD3726
M. abscessus homologs	MAB1869c
Gene Start:	1874566
Gene End:	1875648
Vulnerability Index (VI):	-0.1900
VI Lower Bound:	-0.3980
VI Upper Bound:	0.0360

[AlphaFold] [Orthologs] [Phyre2] [UniProt] [MycoBrowser] [TnSeq DB] [Gaia]

Essentiality:

Call	Condition	Type	Source	Notes
Non Essential	in vitro	CRISPRi	[Bosch & DeJesus et al. (2021)]
Non Essential	in vitro	TnSeq	[Dragset et al. (2019)]

DNA and Protein Sequence help

DNA Sequence

AGCACTAGCAACGTCGACGGGTTGATCACGACCGGCCGCTGCGTGTCCGCGACCCGCGAAGGCATGGCCGGGCTGCGGCACATGGGCACTGTCATGGCGATGGGCCAAGCCGCTGGGACCGCCGCGACAAGGCGTATTCGGCGATCCAAGAGGCGCTCACGCGGGACGGCGCCATCATCACGGCGGCAGACGCCTCACCGACCCCGAGACGGCCGAGCAGAGAACGTCTGCAAGGTGGTCAGGAGGCACAGCATGACCAACATCGCCGCGGGAGCACCGCAGGTGACCACGAGCCGCGTCGCACGCACAGGGGCCGACTCACACTTGAAGACCGGAAGATCGCCTCACCGCACAATGGCGAGGCCGTTGTGCGCGTGGAGAACGTCACGCTCTGCGGCACCGACCTGCACATCTGGGAGGGCGAATACCTCAACCCTCGTCCAGGGACATGAGGCCGCGGGGATCGTCGAGTCCGTCGGAGATCCGGCCGACGCCTCACCGGAACCCGGGTCGTGATGTGCGATCGTGTGGAGAGCACCGGACGCGAAAATGTATGCGAACGCGTATCGGTTGTTACGAGGACGGCACGCTCGCTACCCGGGTCGTCTCTCGGCTCTACATCAGGTACCGGCTGAACTAGGAGCGAGCCATTGCGCTGCAAGCAGTCCGGCGCGGGCGGCCCGTCGCAGGTGAACCGCTGCGGACCGATCGGTCTCATCACGATCATGGCCCTGCGTCGAGCTGGTGTCGATGTCGTCGCGGTCGACACCGTCGAGGAGCGCGCGAGATTCGCCGAGCGTTTCGGTGCAGTCGCGACCATCGCGGTGGCTCCGGGACAAAGGTGTCCGTCGCATGAAGAGGTCGCCGCGGCAGCCGGAAGTGGCCCGACACGGGCTGTCAGTCTCGTCATCGAGGCCACCGGGTCGCCCGCGGCTCTCGCCTCCGCCATCGACGTCGTCTCTCACGCCGGCCGGGTCGTCATCGTCGGAATCTCCGATCAGGATGTCACTATCGAACCATCGCGTTCAAAGAACTCGACGTAGTCGCAACAGCGTGGGCCTGACGGCCTTGGCCTGAGAACCAGGCTGCGTTCAGCAGCCTCATCACGCACCGATCGAAGAAACGGCCGACGCGCTGCGGACCCTCAGGACGGACACGGCACACGTGCGAAAATCAGCATGGGAGCCAGCGTTTAG

Protein Sequence

MTNIAAGAPQVTTSRVARTGGPGRLTLEDRKIASPHNGEAVVRVENVTLCGTDLHIWEGEYLNPFPIVQGHEAAGIVESVGDPADASSLTGTRVVISPVRSCGDCHACRTGRENVCERVSVLGCYEDGTLATRVVVPVSALHQVPDAVPSELAPLSEPASIALQAVRRGRPVAGELALVLGCGPIGLITIMALRRAGVDVVAVDTVEERARFAERFGAVATIAVAPGQRCPSHEEVAAAAGSGPTRAVSLVIEATGSPAALASAIDVVSHAGRVVIVGISDQDVTLPHRTIAFKELDVLGSRNSVGLIPDGLGLIAQNQAAFSSLITHRFPFEETADALRTLRTDTAHVRKVLISMGASV

Vulnerability Assesment help

[Full list of passaging experiments]

Experiment: We designed an M. tuberculosis CRISPRi library (RLC12) to target all annotated Mtb genes with single guide RNAs (sgRNAs) of varying predicted knockdown efficiencies. In parallel, we constructed a M. smegmatis CRISPRi library (RLC11) to target all annotated Msmeg genes, similar to the Mtb sgRNA library. RLC12 was transformed into M. tuberculosis H37Rv; RLC11 into M. smegmatis mc2-155. We passaged both CRISPRi libraries for nearly 30 generations in the presence or absence of the CRISPRi-inducer anhydrotetracycline (ATc). At the indicated timepoints, genomic DNA was harvested and the representation of individual sgRNAs was counted using Illumina sequencing. Here, we show sgRNA log2 fold-change values (L2FC) (plus versus minus ATc) over consecutive generations for sgRNAs targeting the gene you selected. sgRNAs are color-coded based on their predicted strength from blue (strength=0; weak) to red (strength=1; strong).

In order to quantify gene vulnerability, data were subsequently analyzed with a hierarchical model at the sgRNA level (two-line model) and gene level (Hill curve). The vulnerability quantification is shown below. [More information]

	M. smegmatis Reference Fitness Experiment	M. tuberculosis H37Rv Reference Fitness Experiment	M. tuberculosis HN878 Reference Fitness Experiment



	M. smegmatis Gene-Level Logistic Regression	M. tuberculosis H37Rv Gene-Level Logistic Regression (Most similar ortholog)	M. tuberculosis HN878 Gene-Level Logistic Regression (Most similar ortholog)


Vulnerability Index (VI)	-0.1900	1.0600
VI Lower Bound	-0.3980	-0.4280
VI Upper Bound	0.0360	3.5770

MSMEG1795 (MSMEG1795)

Essentiality:

DNA Sequence

Protein Sequence

Specific References

General References