×
Error: Could not find gene with ID = 'MSMEG6737' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4350' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1599' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6632' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4735' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0462' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3837' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4042' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0460' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6738' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3928' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2632' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6794' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2628' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6720' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3527' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2782' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1284' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3835' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1392' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3458' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1994' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1646' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6682' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2856' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5704' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3331' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3969' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2783' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1193' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2353' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0135' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5276' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6050' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2074' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2938' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6737' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4350' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1599' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6632' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4735' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0462' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3837' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4042' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0460' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6738' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3928' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2632' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6794' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2628' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6720' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3527' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2782' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1284' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3835' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1392' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3458' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1994' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1646' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6682' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2856' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5704' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3331' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3969' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2783' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1193' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2353' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0135' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5276' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6050' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2074' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2938' and Strain = 'H37Rv'
MSMEG4149
ms4149
-
M. smegmatis
·
MC2-155
MC2-155 Coordinates:
4229192 – 4230127
Vulnerability Index (VI) :
0.3330
M. tuberculosis homologs hsaG
M. abscessus homologs MAB4374 , MAB0625
Sequence
Essentiality
Vulnerability
Notes (0)
help_outline
Click the tabs above to view different types of data for this gene. The Vulnerability tab shows CRISPRi fitness data.
DNA and Protein Sequence
help
DNA Sequence
AGGTCGAGGGCCGCAACGACTCCACCGCGGCCCGGAA
CTCCTTC AGCGGAAGA
CTTCCCGG GGGCAGTGGGGGCGTCGCGGTGGCGCGTTCGAGAA
ATGCCCT CGTCGGTTCATCCAACGTCACGACAGACCTCCGGTCTTGTTGTTGCA
GTGCTGG TTTCAGGGTGAGGCTATGGCGATCAATCTGTGGTGTCCATTCGTGAAATCCAAAGTGGCTGTACGCGAAACGCTGATAGACGGCCGCTGCGCGGGCCAACATACTGAATTGGCCGAAATCCGGAGAACAGTCGGGAGAGACC
ATGGACAAGGTGAAGGTCGCGATCATCGGATCCGGCAACATCGGTACCGACCTGATGATGAAGACCCTGCGTTCTTCTTC GCTCGAGATGGCGGTGCTCG TGGGGGTCGATCCGCGGTCGGATGGCCTGGCCAGGGCGGAGCGACTCGGAATCGCCACCACCTCCGGCGGCTTGGATCATTTCGTCACGACGCCCGAATTCGAGGATGTGGCGATCGTCTTCGACGCAACCTCCGCCGCCGCACACGAGCGGCACGCATCCATCCTGG CCCAGCTGAACAAGCAGGTGGTCGATCTCACGCCTGCCGC TGTGGGGCCATATGTGATTCCGA CGGTCAATATGGACCGCGTCGTAGGAGAGCCCAACGTGAACATGGTGACCTGTGGTGGGCAGGCGACCGTGCCGA TCGTCGCCGCGATTTCCGG TGTGACCCCCGTGCACTACGCCGAGATCGTCGCGTCGATCGCCTCGCGGTCGGCGGGCCCCGGCACCAGGGCGAACATCGACGAGTTCACCGAGACAACCGCACTGGCGCTGGAGAGTGTCGGCGGCGCCACTCAAGGAAAGGCGATCATCGTACTGAATCCGGCGGAACCACCCCTTATCATGCGCGACACGGTGCTCTGCCTC TGTGACGAGGCAGACGAGACGGAAATCGAGGCCGCGGTCGAGCGGATGGTCGCTTCGGTCGCAGAGTTCGTCCCTG GCTACCGGCTCAAGCAGAAGGTGCAGTTCCAG CGGTACACCCGGAATTCCCCA CTCCGACTACCAGAGCAAGAGGCTGACTTCACCGGGCTCCAGGTTTCGGTTTTCCTCG AGGTAGAAGGGGCTGCCCA TTACCTTCCCGC CTACGCGGGAAATCTCGACATCATGACCTCCGCAGCATTGCGGACCGCGGAACGTATGACCGAACTTGACGCGATTCGGGGGAAGTGA
Protein Sequence
MDKVKVAIIGSGNIGTDLMMKTLRSSSLEMAVLVGVDPRSDGLARAERLGIATTSGGLDHFVTTPEFEDVAIVFDATSAAAHERHASILAQLNKQVVDLTPAAVGPYVIPTVNMDRVVGEPNVNMVTCGGQATVPIVAAISGVTPVHYAEIVASIASRSAGPGTRANIDEFTETTALALESVGGATQGKAIIVLNPAEPPLIMRDTVLCLCDEADETEIEAAVERMVASVAEFVPGYRLKQKVQFQRYTRNSPLRLPEQEADFTGLQVSVFLEVEGAAHYLPAYAGNLDIMTSAALRTAERMTELDAIRGK
Vulnerability Assessment
help
You do not have permission to view notes.