Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7f4436cfaf90>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7f443e462810>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7f4431071f40>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7f443e4623f0>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7f443e460dd0>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7f442ca52ab0>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7f4431071730>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7f4436cfa4b0>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7f443e461850>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7f443e463c50>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7f443614f980>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7f443e4602f0>>.

MSMEG4307 (MSMEG4307)


Species:	M. smegmatis
Strain:	MC2-155
PATRIC Annotation:	-
Synonyms:
M. tuberculosis homologs	RVBD2230c
M. abscessus homologs	MAB1903
Gene Start:	4397147
Gene End:	4398298
Vulnerability Index (VI):	0.4770
VI Lower Bound:	0.0240
VI Upper Bound:	1.0350

[AlphaFold] [Orthologs] [Phyre2] [UniProt] [MycoBrowser] [TnSeq DB] [SeqHub]

Essentiality:

Call	Condition	Type	Source	Notes
Non Essential	in vitro	CRISPRi	[Bosch & DeJesus et al. (2021)]
Non Essential	in vitro	TnSeq	[Dragset et al. (2019)]

DNA and Protein Sequence help

DNA Sequence

ACGCGGCCAGTCACAACATCGGTCACACACCGATTATCGCGGCACCGATGTCACGGCGGCCGACCACTACTGTCGTGGGTCACCTCCCGCGCGGCCGCCGTACCGGCGTGGCCGACCGCGCCCATGCGGGCGCCGTTTGTGCAGTTCGCCACACAGAGGACGACATGGGCAAAGCAGGAGCAGCGGCGTTGCGATACTTTCGTGGGCTCGCGGGTGGGACGGAGGATGAACACGCCATCGGCGGGCGTGCGGCTGGCCGACGTGATCGCCAGGCGGCGTACCCGCCGCAACTCGCGCAGGACTGGGATTCGGTCGGTCTGGTGTGCGGGGACCCCGACGAACCCGTCGAGTCGGTCACGATCGCGGTCGACGCCACCGCCGACGTGATCGCCGAGACCGCGGGCTCACCACCCGGCGGTGTCGACACCGTCGCCGCGAGCACCGCCAAGGGCGCGCTGATCCACCGGCTGATCCGCACCGGGCGCGCACTGTTCACCGCGCACACCAACGCCGACTCGGCCACGTGTCCGACGCGCTGGCCGAGACGCTGGGGTTGCGTGTCGAGGACCGCCCGTGGCGGCCGGGCCGAACCTGGACAAGTGGGTGGTGTTCCGGCCGACGCCGACGCGCTGCGCGAGGCGTTGTTCGCCGCAGGCGCGGGCCGCATCGGTGACTACTCGCACTGCAGTTGGAGCGTCGCGGGCACCGGGCAACGACGGCGCCTCGCCCGCGATCGGTGAAGTGGGGACCGTCGAGCAAGTGAGCGAGGACCGCGTCGAGGTGATCGCGCCGGCACGGCTGCGCGCGAAGGATGCGCATCCATACGAGGAACCCGCGTTCGACTCGCGCCGTGACGTGGGCATCGGCCGCATCGCGTCAAACCGGAGCCGTTGTCGGCGTTCGTCAGGCGCGTGCGCGCGGCGCGACCTCGTGGGGCGTGCGCGCATCGGGTGATCCGGACGCCGTGGTGTCGCGCGTCGCGGTGTGCGGGGGAGCGGGCGACTCGGACCGCGGCCGGTGTGCAGGCCTATGTCACAGCCGATCTTCGGCACCACCCCGCCGACGAGCACCGCAGGGCCTCGGACGTCGCGCTGGTCGATGTGGCGCACTGGGCCAGCGAGGTGCGCCCAGGCCGCGGGCGCAAGCATTTTTCGGACGCATGCGGGTCTGCGAGGTCCGCACCGATCCATGGAATGTCGAGAGTTTGGAAGAACATGAAAGCTGA

Protein Sequence

MNTPSAGVRLADVIAVLEAAYPPQLAQDWDSVGLVCGDPDEPVESVTIAVDATADVIAEVPDRGLLLAHHPLLLRGVDTVAASTAKGALIHRLIRTGRALFTAHTNADSANPGVSDALAETLGLRVEDVLSPVAAGPNLDKWVVFVPAADADALREALFAAGAGRIGDYSHCSWSVAGTGQFLPHDGASPAIGEVGTVEQVSEDRVEVIAPARLRAKVLAAMRAAHPYEEPAFDILPLAPIPGDVGIGRIASLPEPEPLSAFVRRVRAALPPTSWGVRASGDPDAVVSRVAVCGGAGDSLLGAVTAAGVQAYVTADLRHHPADEHRRASDVALVDVAHWASEFPWCAQAAGVLRKHFSDALPVRVCEVRTDPWNVESLEEHES

Vulnerability Assesment help

[Full list of passaging experiments]

Experiment: We designed an M. tuberculosis CRISPRi library (RLC12) to target all annotated Mtb genes with single guide RNAs (sgRNAs) of varying predicted knockdown efficiencies. In parallel, we constructed a M. smegmatis CRISPRi library (RLC11) to target all annotated Msmeg genes, similar to the Mtb sgRNA library. RLC12 was transformed into M. tuberculosis H37Rv; RLC11 into M. smegmatis mc2-155. We passaged both CRISPRi libraries for nearly 30 generations in the presence or absence of the CRISPRi-inducer anhydrotetracycline (ATc). At the indicated timepoints, genomic DNA was harvested and the representation of individual sgRNAs was counted using Illumina sequencing. Here, we show sgRNA log2 fold-change values (L2FC) (plus versus minus ATc) over consecutive generations for sgRNAs targeting the gene you selected. sgRNAs are color-coded based on their predicted strength from blue (strength=0; weak) to red (strength=1; strong).

In order to quantify gene vulnerability, data were subsequently analyzed with a hierarchical model at the sgRNA level (two-line model) and gene level (Hill curve). The vulnerability quantification is shown below. [More information]

	M. smegmatis Reference Fitness Experiment	M. tuberculosis H37Rv Reference Fitness Experiment	M. tuberculosis HN878 Reference Fitness Experiment



	M. smegmatis Gene-Level Logistic Regression	M. tuberculosis H37Rv Gene-Level Logistic Regression (Most similar ortholog)	M. tuberculosis HN878 Gene-Level Logistic Regression (Most similar ortholog)


Vulnerability Index (VI)	0.4770	-2.1610
VI Lower Bound	0.0240	-6.9690
VI Upper Bound	1.0350	3.2710

MSMEG4307 (MSMEG4307)

Essentiality:

DNA Sequence

Protein Sequence

Specific References

General References