×
Error: Could not find gene with ID = 'MSMEG6219' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1495' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1314' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3781' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1266' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1309' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3461' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6620' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2694' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3923' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5824' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1357' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0557' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0642' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4719' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1619' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2357' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2519' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0314' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1626' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3411' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2696' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2623' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5825' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3711' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5820' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2359' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3894' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5056' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1796' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4762' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5422' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6023' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0287' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4717' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4842' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2746' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2430' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6219' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1495' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1314' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3781' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1266' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1309' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3461' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6620' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2694' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3923' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5824' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1357' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0557' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0642' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4719' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1619' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2357' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2519' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0314' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1626' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3411' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2696' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2623' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5825' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3711' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5820' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2359' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3894' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5056' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1796' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4762' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5422' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6023' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0287' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4717' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4842' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2746' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2430' and Strain = 'H37Rv'
fdhD
ms4669
-
M. smegmatis
·
MC2-155
MC2-155 Coordinates:
4757345 – 4758169
Vulnerability Index (VI) :
0.2260
M. tuberculosis homologs fdhD
M. abscessus homologs MAB1592c
Sequence
Essentiality
Vulnerability
Notes (0)
help_outline
Click the tabs above to view different types of data for this gene. The Vulnerability tab shows CRISPRi fitness data.
DNA and Protein Sequence
help
DNA Sequence
GACCGCTACCGCGGCGTGAAGGGCGGCAGGCGCGTGGTGTTCGTCAACCCCACCGACATCGCCCGCCTCGGGCTCAAGCCCGACGACCGGGTGGACCTGATCTCGGAGTTCGAAGGCCAGGAACGGTGGGCCAAGGA
CTTCCTGG TG
GTGCCGT ACTCGACGCCCGAGGGCAACGCCGCGGCCTACTACCCCGAGACCAATCCGCTG
GTGCCGC TTGACCATACGGCCAAGAAGTCCAACACGCCGGTGTCCAAGGCCGTCGTCGTCAGGCTGCAGCGCCGCGAGGGAAGCGCGTCGTA
ATGGGCCGCGTGACCGCGCGGCGCCGCGCCCACCACGTGACCCTGGACCGGTCGGAGGCCCGCCCCGAGACACTCGTCGTCGAAGAGCCCCTGGAGATCCGGGTCAACGGCACGCCCATCACGGTCACCATGCGCACCCCCGGCTCCGATATCGAACTGGCACAAGGGTTCCTGCTCA CCGAGGGCGTGATCCGCAGGCGCGACGACCTTCTCG CGGTGCGGTACTGCCGC GGCGCCACCGAGGACGGGGTCAACACCTACAACGTGCTGG ACGTGACGCTGGCGCCCGATGTCCCGG CACCCGACGTGGACGTCACCCGCAACTTCTAC ACCACCTCGTCGTGCGGGGTGTGCGGCAAGGCCTCGCTGGAGGCCGTCCGCCTGATCAGCAAGCACTGTCCGGGCGACGATCCGGCCACCATCACGGCCGAGACGCTCGCGTCGATGCCCA CGCAGTTGCGGCGTGCCCA GAAGGTGTTCAACAGCACCGGCGGCCTACACGGCGCCGCGCTGTTCGACGCCGACGGGAACATGCTGG TGGTCCGTGAGGACATCGGCAGGCACAACGCGGTGGACAAGGTGATCGGCTGGGCCGTCGAGCAGGAGCGGGTCCCGT TGTCCGGCACCGTGCTGCTGG TGAGCGGCCGCGCGTCCTTC GAACTCACCCAGAAGGCCGTCATGGCCGGCATCCCCGTGCTGG CCGCGGTGTCGGCACCGTCGTCGCTCGCGGTGGACCTCGCGAGCCAGTCGGGGCTGACGCTCGTGGCGTTCCTGC GTGGCGAGTCGATGAACGTCTACACCCGTCCCGA TCGTGTCATGAACTGA
Protein Sequence
MGRVTARRRAHHVTLDRSEARPETLVVEEPLEIRVNGTPITVTMRTPGSDIELAQGFLLTEGVIRRRDDLLAVRYCRGATEDGVNTYNVLDVTLAPDVPAPDVDVTRNFYTTSSCGVCGKASLEAVRLISKHCPGDDPATITAETLASMPTQLRRAQKVFNSTGGLHGAALFDADGNMLVVREDIGRHNAVDKVIGWAVEQERVPLSGTVLLVSGRASFELTQKAVMAGIPVLAAVSAPSSLAVDLASQSGLTLVAFLRGESMNVYTRPDRVMN
Vulnerability Assessment
help
You do not have permission to view notes.