×
Error: Could not find gene with ID = 'MSMEG0573' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0340' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6735' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0437' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3901' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4795' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3487' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6775' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4848' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4467' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4150' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0616' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6385' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3680' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5384' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3483' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6732' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5322' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3672' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2875' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0302' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3679' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3241' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3248' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2483' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2576' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1880' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5385' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5841' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2541' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6797' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5079' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0345' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0573' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0340' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6735' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0437' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3901' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4795' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3487' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6775' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4848' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4467' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4150' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0616' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6385' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3680' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5384' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3483' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6732' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5322' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3672' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2875' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0302' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3679' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3241' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3248' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2483' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2576' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1880' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5385' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5841' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2541' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6797' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5079' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0345' and Strain = 'H37Rv'
mutM
ms2419
-
M. smegmatis
·
MC2-155
Sequence
Essentiality
Vulnerability
Notes (0)
help_outline
Click the tabs above to view different types of data for this gene. The Vulnerability tab shows CRISPRi fitness data.
DNA and Protein Sequence
help
DNA Sequence
GCCTGACCGTTGTCCGCGAGGTC
ATCCTGC GCCTGTTCGGCGAG
CTCCTCG ACACCGCGCCCACCCTCGGTGCGGGCCTGGACTGGAAGAGCAGTCTGCAGGAACTCACCGCGGCGCGCGGTCTCGGCGCACCGGCGTACGTGGTGACCTCGACCGGGCCCGATCACGACAAGGA
GTTCTCG GCCACCGTGGTGATCGGCGAGGCCGAGTACGGCCACGGTGTGGGCCGGACCAAGAAAGAGGCCGAACTCAAGGCCGCCGCGAGCGCCTACAAGACGCTCGACGAGTCGTGATCGCCG
ATGCCTG AGCTTCCCGA GGTCGAGGTCGTCCGCCGCGGGCTGGCCGAGCATGTGACGGGAAAGACGATCACCGGTGTGCGCGTGCACCATCCGCGGGCGGTGCGTCGCCACGAGGCCGGCCCGGCGGATCTCACCGCACGACTGCTCG ACGTGCGGATCACCGGCACCGGCAGGCGCGGAAAGTACCTGTGGCTCACCCTCGATGACTCCGCGGCGTTGGTGGTGCATCTCGGGATGAGCGGGCAGATGCTGCTCG GCCCGATCCGTGACACGCGGCACCTGCGCATCGCGGCGGTGCTCG ACGACGGGACCGCACTGAGCTTCGTCGATCAGCGCACGTTCGGCGGGTGGCAATTGACCGAGATGGTCACGGTCGACGGCACCGATGTGCCGG AGCCGGTGGCGCACATCGCGCGTGACCCCCTCGATCCGCTCTTCGATCGCGACCGTGTCGTCACGGTGTTGCGGGGCAAGCACTCCGAGATCAAACGTCAACTGCTGG ACCAGACCGTGGTGTCCGGCATCGGCAACATCTACGCCGACGAGGCCCTGTGGCGCACGAAGATCAACGGGGCGCGCATCGCCGCGGCCCTGCCGC GCCGCCGTCTCGCCGAACTGCTCG ACGCCGCGGCCGAGGTCATGACCGATGCCCT CGGACAGGGCGGCACGTCGTTCGATTCGTTGTACGTCAACGTCAACGGTGAGTCCGGGTACTTCGACCGGTCGTTGGACGCCTACGGCCGCGAGGGTGAGCCGTGCCGG CGGTGCGGTGCGATCATGCGCCGCGAGAAGTTCATGAACCGCTCGTCGTTCTACTGCCCG AGATGTCAGCCGCGTCCGCGGGTGCCTC GGGTCTGA
Protein Sequence
MPELPEVEVVRRGLAEHVTGKTITGVRVHHPRAVRRHEAGPADLTARLLDVRITGTGRRGKYLWLTLDDSAALVVHLGMSGQMLLGPIRDTRHLRIAAVLDDGTALSFVDQRTFGGWQLTEMVTVDGTDVPEPVAHIARDPLDPLFDRDRVVTVLRGKHSEIKRQLLDQTVVSGIGNIYADEALWRTKINGARIAAALPRRRLAELLDAAAEVMTDALGQGGTSFDSLYVNVNGESGYFDRSLDAYGREGEPCRRCGAIMRREKFMNRSSFYCPRCQPRPRVPRV
Vulnerability Assessment
help
You do not have permission to view notes.