×
Error: Could not find gene with ID = 'MSMEG6846' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1285' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4737' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4750' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4855' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2389' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4345' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6080' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0677' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6033' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5963' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2984' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3669' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3474' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4500' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3480' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6900' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6432' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6516' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3750' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5503' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5772' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1373' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3683' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4675' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1606' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3596' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2571' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2809' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1376' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0450' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0294' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2928' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0819' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4908' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0307' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3592' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2877' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3182' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4409' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6846' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1285' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4737' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4750' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4855' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2389' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4345' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6080' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0677' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6033' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5963' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2984' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3669' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3474' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4500' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3480' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6900' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6432' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6516' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3750' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5503' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5772' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1373' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3683' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4675' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1606' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3596' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2571' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2809' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1376' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0450' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0294' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2928' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0819' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4908' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0307' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3592' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2877' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3182' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4409' and Strain = 'H37Rv'
MSMEG2443
ms2443
-
M. smegmatis
·
MC2-155
MC2-155 Coordinates:
2525199 – 2525504
Vulnerability Index (VI) :
0.5960
M. tuberculosis homologs Rv2901c
M. abscessus homologs MAB3221c
Sequence
Essentiality
Vulnerability
Notes (0)
help_outline
Click the tabs above to view different types of data for this gene. The Vulnerability tab shows CRISPRi fitness data.
DNA and Protein Sequence
help
DNA Sequence
CGGGCCGTGCGTGGAGCACCGGTACTCGTATGTGAACGTGCGGCGGGCCGCCGAGGCGACCGGTGTGCGCTGGGCCTCGGACCGGGTGGGCGTGCGGTGGTCCACCGAGTCGGCGGCCGAGACCGAAGAGGTACGACGGGCGCTTGAGGCGTTTGAGGTCGAGTGGGTTACGGCACCCGTGGAGCACGAGG
ATGCCGC GTGCGCGAAGATGGGCAGTGGATGACCGCGCCGACAACAGACAAGCCAAGAGCAGACAATGTGATCAAGGCAGTGACCCTACGAGAAGGACAGCAGAGCAG
ATGAGCGCCGAAGATCTCGAGAAGTACGAAACCGAGATGGAGCTCTCGCTGTACCGCGAATACAAGGACATCGTCGGTCAGTTCAGCTACGTCGTGGAGACCGAACGCCGCTTCTAC CTCGCGAACAGTGTGGAGCTCATTCCAC GGAATGCAGATGGCGAGGTGTATTTCGAGCTCCGGCTGGCCGACGCCTGGGTGTGGGACATGTACCGGCCCGCCCGCTTCGTCAAGCAGGTCCGGGTGATCACGTTCAAGGACGTCAACATCGAGGAAGTGGAGAAGCCGGAGTTGCGGCTCCCCG AGTAG
Protein Sequence
MSAEDLEKYETEMELSLYREYKDIVGQFSYVVETERRFYLANSVELIPRNADGEVYFELRLADAWVWDMYRPARFVKQVRVITFKDVNIEEVEKPELRLPE
Vulnerability Assessment
help
You do not have permission to view notes.