×
Error: Could not find gene with ID = 'MSMEG6846' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1285' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4737' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4750' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4855' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2389' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4345' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6080' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0677' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6033' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5963' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2984' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3669' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3474' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4500' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3480' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6900' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6432' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6516' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3750' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5503' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5772' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1373' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3683' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4675' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1606' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3596' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2571' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2809' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1376' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0450' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0294' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2928' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0819' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4908' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0307' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3592' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2877' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3182' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4409' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4963' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6922' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6076' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5525' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3442' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4495' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2963' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0167' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6129' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6846' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1285' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4737' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4750' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4855' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2389' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4345' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6080' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0677' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6033' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5963' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2984' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3669' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3474' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4500' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3480' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6900' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6432' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6516' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3750' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5503' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5772' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1373' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3683' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4675' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1606' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3596' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2571' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2809' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1376' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0450' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0294' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2928' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0819' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4908' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0307' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3592' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2877' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3182' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4409' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4963' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6922' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6076' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5525' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3442' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4495' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2963' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0167' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6129' and Strain = 'H37Rv'
sufB
ms3122
-
M. smegmatis
·
MC2-155
MC2-155 Coordinates:
3197224 – 3198657
Vulnerability Index (VI) :
-4.9420
M. tuberculosis homologs Rv1461
M. abscessus homologs MAB2749c
Sequence
Essentiality
Vulnerability
Notes (0)
help_outline
Click the tabs above to view different types of data for this gene. The Vulnerability tab shows CRISPRi fitness data.
DNA and Protein Sequence
help
DNA Sequence
ACCACCACGGCACCGGTGAGCGGGCCGATCCGCGGCGTACAGAT
CTGCCAG CACCACTGTCCGGTGTCGCACGTGGCCGAGGA
ATTCCCGG AACTGTGCGAGACGGAGCGCGAGGCGTTCGCCGAG
ATCCTCG GCACCCACGTGCAGCGCCTGGCCACCATCGTCAACGGTGACTGCGCGTGCACCACCCAC
GTCCCGC TGGACCTCGACCCGCCCGGCGAGCACACAGACCACCCGAAAGACGTCCGGAGCACAGCCCGCGACCGGACGACCACCCCTAGCGATCAAGGAGCGTCGAC
ATGACGACCACCCCCGAGACAGCGCCACTGACCCAGGAAGAGACCATCGCGTCCCTG GGTAAGTACGGCTACGGCTGGGCGGATTCCGA CGTTGCCGG CGCCAGCGCGCAGCGTGGTCTCAACGAGGCGGTCGTACGCGACATCTCGGCCAAGAAGAACGAGCCCGAGTGGATGCTCG ACATCCGGTTGAAGGCGCTGCGCACCTTCGACAAGAAGCCCATGCCGA CCTGGGGATCGGACCTCGACGGCATCGACTTCGACAACATCAAGTACTTCGTGCGGTCCACCGAGAAGCAGGCGGCCTCGTGGGAGGAACTGCCCG AGGACATCCGCAACACCTACGACAAGCTGGGCATCCCGG AAGCCGAGAAGCAGCGCCTGGTCTCCGGTGTGGCCGCGCAGTACGAGTCCGAGGTGGTCTACCACCAGATCCGCGAGGACCTCGAGGCCCAGGGCGTCATCTTCCTCG ACACCGACTCCGCGCTGCGTGAGCATCCCGA GATCTTCAAGCAGTACTTCGGCACCGTGATCCCGG CCGGCGACAACAAGTTCTCG GCGCTGAACACCGCGGTGTGGTCGGGCGGTTCGTTCATCTACGTCCCGC CGGGTGTGCACGTCGACATCCCGC TGCAGGCCTACTTCCGG ATCAACACCGAGAACATGGGCCAGTTCGAGCGCACGTTGATCATCGTCGACGAGGGTGCCTA CGTGCACTACGTCGAAGGATGTACCGCGCCCATCTACAAGAGCGACTCGCTGCACTCGGCCGTCGTCGAGATCATCGTCAAGGCCGGCGGCCGCTGCCGC TACACGACCATCCAGAACTGGTCGAACAACGTCTACAACCTGGTCACCAAGCGTGCCCG CGCCGAGGCGGGCGCCACCATGGAGTGGATCGACGGCAACATCGGCTCCAAGGTGACCATGAAGTACCCGGCCGTGTGGATGACCGGTGAGCACGCCAAGGGCGAGGTGCTCT CGGTGGCGTTCGCCGGCGAGGGCCAGCACCAGGACACCGGTGCCAA GATGCTGC ACCTCGCGCCGAACACGTCGAGCAACATCGTCTCGAAGTCGGTCGCGCGAGGCGGCGGACGCGCGTCCTAC CGCGGCCTGGTCCAGGTCAACAAGGGAGCACATGGGTCGCGCTCCTCT GTGAAATGCGATGCGCTGCTGG TCGACACGATCAGCCGGTCCGACACCTACCCGTACGTCGACATCCGCGAGGACGACGTGACGATGGGCCACGAGGCCACGGTGTCGAAGGTCAGCGAGGATCAGCTGTTCTAC CTGATGAGCCGCGGGCTGACCGAGGACGAGGCCATGGCCATGGTGGTCCGCGGCTTCGTCGAGCCGATCGCCAAGGAACTGCCGA TGGAATACGCGCTCGAGCTCAACCGGCTCATCGAGCTTCAGATGGAAGGTGCGGTCGGCTGA
Protein Sequence
MTTTPETAPLTQEETIASLGKYGYGWADSDVAGASAQRGLNEAVVRDISAKKNEPEWMLDIRLKALRTFDKKPMPTWGSDLDGIDFDNIKYFVRSTEKQAASWEELPEDIRNTYDKLGIPEAEKQRLVSGVAAQYESEVVYHQIREDLEAQGVIFLDTDSALREHPEIFKQYFGTVIPAGDNKFSALNTAVWSGGSFIYVPPGVHVDIPLQAYFRINTENMGQFERTLIIVDEGAYVHYVEGCTAPIYKSDSLHSAVVEIIVKAGGRCRYTTIQNWSNNVYNLVTKRARAEAGATMEWIDGNIGSKVTMKYPAVWMTGEHAKGEVLSVAFAGEGQHQDTGAKMLHLAPNTSSNIVSKSVARGGGRASYRGLVQVNKGAHGSRSSVKCDALLVDTISRSDTYPYVDIREDDVTMGHEATVSKVSEDQLFYLMSRGLTEDEAMAMVVRGFVEPIAKELPMEYALELNRLIELQMEGAVG
Vulnerability Assessment
help
You do not have permission to view notes.