×
Error: Could not find gene with ID = 'MSMEG3817' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6369' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1625' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3478' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6710' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6060' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3298' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1356' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2518' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5744' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5827' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1910' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5799' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0457' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6025' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2616' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1888' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0651' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3004' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1150' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5857' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3253' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5423' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1378' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2356' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5305' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0315' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3662' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5457' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3878' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5741' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0303' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1620' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5996' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3242' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5826' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5823' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2429' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4905' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3462' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3817' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6369' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1625' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3478' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6710' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6060' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3298' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1356' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2518' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5744' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5827' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1910' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5799' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0457' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6025' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2616' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1888' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0651' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3004' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1150' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5857' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3253' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5423' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1378' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2356' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5305' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0315' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3662' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5457' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3878' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5741' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0303' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1620' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5996' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3242' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5826' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5823' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2429' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4905' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3462' and Strain = 'H37Rv'
MSMEG6354
ms6354
-
M. smegmatis
·
MC2-155
MC2-155 Coordinates:
6413230 – 6413949
Vulnerability Index (VI) :
0.2430
M. tuberculosis homologs cut5a , cut1 , cut5b , cut4 , cfp21 , [+ 2 remaining orthologs]
M. abscessus homologs MAB3272c , MAB3809c , MAB3763 , MAB3766 , MAB4405 , [+ 1 remaining orthologs]
Sequence
Essentiality
Vulnerability
Notes (0)
help_outline
Click the tabs above to view different types of data for this gene. The Vulnerability tab shows CRISPRi fitness data.
DNA and Protein Sequence
help
DNA Sequence
CGCGGCCTGGAACTCGGC
GTTCCTGCCGT CGAAGGACCTCGCCGAGGCGGTGACGGCGATGTTCGAAAAGCGCAGGCCCGAGTTCACCGGCGAGTAGCACCCCCTCAGCGAAACCCGCTGGCCCGCAGAGCCTGTCGAGAACGGCCTGCGACGGCCTCCGCCGGCAAAG
CTGCCGA CT
TTGCCGC GCCGTCGC
GTCCCGA CGATTTCGGCTCCGCAGGTTTGGTTTTCGGCGATCGCGGCA
ATTCCCGC ATGCGGCAATGGCGCCACGGATTCGCTGTCGAGCTTTGGGGGTCGGGTCG
GTGTTCAAGAGCACGCTTTCACGTTTCATTCCCGC GGTGTCCGCGGCGCTGTTGACCGCGGGCCTGGTCCCCG GTACGGCGGGCACCGCCAACGCCGAACCGCCGATCGAGGGCGCGGCGCCACCGTGCCCG GATGTCGAGGTGGTGTTCGCGCGCGGCACGTTCGAGCCGCCGGGTGTGGGGTTCGTCGGGCAAGCGTTCGTCGATGCGCTGCGCGGCAGGCTGGGCGACAAGAGCGTGGACGTGTACGCGGTGAATTACCCTGCGTCGCTTGACTTCCAG CGCGCAGCGGACGGAATCGTCGACGCCAGCCGCAAGGTCGAGCAGACCGCGGCGACGTGCCCG TCGACCAAGACCGTCATCGGCGGTTTCTCG CAGGGCGCCGCGGTGGCCGCCTACCTGACGGCCGACTCCGTGCCCG CGAATTTCGTACTGCCCG ACGGGATCACGGGGCCCATGCCCG ACGACGTGGCCAAGCACGTCACCGCGGTGACGCTGTTCGGGAAACCCTCCAACGGGTTCATCAACACCGTGCAGTCCACGGCGCCGCCCATCAACATCGGGCACCTGTACACCGACAAGACCGTCGACCTGTGCATCGAGACGGACCCCGTGTGCTCG CCCACCGGCAGCGACGGGGCCAGCCACAACCTGTACGCGACCAACGGCATGGTCCAACAGGCCGCCGACTACGTCGCCGCGCGAGTCCTGCCGC AGTGA
Protein Sequence
VFKSTLSRFIPAVSAALLTAGLVPGTAGTANAEPPIEGAAPPCPDVEVVFARGTFEPPGVGFVGQAFVDALRGRLGDKSVDVYAVNYPASLDFQRAADGIVDASRKVEQTAATCPSTKTVIGGFSQGAAVAAYLTADSVPANFVLPDGITGPMPDDVAKHVTAVTLFGKPSNGFINTVQSTAPPINIGHLYTDKTVDLCIETDPVCSPTGSDGASHNLYATNGMVQQAADYVAARVLPQ
Vulnerability Assessment
help
You do not have permission to view notes.