×
Error: Could not find gene with ID = 'MSMEG1622' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0881' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1501' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5318' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6757' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4816' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4527' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1106' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2765' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0586' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1377' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4531' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3684' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3437' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2472' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6848' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6053' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5773' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6834' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2663' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4344' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3187' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2095' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1940' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3543' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5828' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5084' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG1576' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3780' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6074' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG0470' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG3833' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG2785' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4673' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG6247' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG4893' and Strain = 'H37Rv'
×
Error: Could not find gene with ID = 'MSMEG5022' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1622' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0881' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1501' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5318' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6757' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4816' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4527' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1106' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2765' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0586' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1377' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4531' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3684' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3437' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2472' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6848' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6053' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5773' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6834' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2663' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4344' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3187' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2095' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1940' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3543' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5828' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5084' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1576' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3780' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6074' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0470' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3833' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2785' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4673' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6247' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4893' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5022' and Strain = 'H37Rv'
rplO
ms1474
-
M. smegmatis
·
MC2-155
MC2-155 Coordinates:
1565694 – 1566137
Vulnerability Index (VI) :
-12.9790
M. tuberculosis homologs rplO
M. abscessus homologs rplO
Sequence
Essentiality
Vulnerability
Notes (0)
help_outline
Click the tabs above to view different types of data for this gene. The Vulnerability tab shows CRISPRi fitness data.
DNA and Protein Sequence
help
DNA Sequence
AGTGGCGGCCCGTCGCGGT
CTGCCCA TCGAGGACGTTGCGCCGGCCGGC
ATGCTGA AGGCCCGGCGCGAGAGTGAAGCGCTGGCCGCCGCGGCTGCGCGTGAGGGATCGGCATAACCATGGCAGAGCTGAAGATCACCCAGGTGCGTAGCACCATCGGGGCGCGCTGGAAGCAGCGTGAGAGCCTGCGGACCCTGGGCCTCAAGAAGATCCGCCAGTCGGTGGTGCGTGAGGACAACGCCCAGACCCGTGGCCTCATCAATACCGTTCACCACCTCGTTGAAGTAGAGGAGGTTGGCAA
GTGAGCGTCATCAAGCTGCACGACCTGAAGCCGGCTCCCGG AGAGAAGAAGGCCAAGACCCGCGTCGGTCGTGGTGAGGGCTCGAAGGGCAAGACCGCAGGCCGTGGTACCAAGGGCACGAAGGCCCGCAAGAACGTCCCCG TGATGTTCGAGGGCGGCCAGATGCCGA TCCACATGCGGCTGCCGA AGCTCAAGGGCTTCAAGAACCGCTTCCGC ACCGAGTACCAGGTCGTCAACGTCGGCGACATCAACAAGGCCTTCCCGC AGGGTGGCACGGTTGGTGTCGACGAGCTGGTGGCCAAGGGCCTGGTTCGCAAGAACAGCCTGGTCAAGGTTCTCG GCGACGGCAAGCTGACCGTCAAGGTCGACGTGACCGCCAACAAGTTCAGCGGTAGCGCCCGCGAGGCGATCACCGCGGCCGGCGGTTCGGCCACCGAACTCTGA
Protein Sequence
VSVIKLHDLKPAPGEKKAKTRVGRGEGSKGKTAGRGTKGTKARKNVPVMFEGGQMPIHMRLPKLKGFKNRFRTEYQVVNVGDINKAFPQGGTVGVDELVAKGLVRKNSLVKVLGDGKLTVKVDVTANKFSGSAREAITAAGGSATEL
Vulnerability Assessment
help
You do not have permission to view notes.