Ms1726 (MSMEG1726)

Could not find gene with ID = 'MSMEG4626' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3868' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0684' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1722' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1337' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2943' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1599' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2375' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2384' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2053' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3795' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1965' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2075' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0090' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5225' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2480' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6286' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2763' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4670' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3698' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG5370' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6202' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1695' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3128' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3218' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6032' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2445' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG3158' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2591' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4637' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4594' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1072' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG6875' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG1608' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4807' and Strain = 'H37Rv'

MSMEG1726

ms1726

M. smegmatis · MC2-155

[AlphaFold] [Orthologs] [Phyre2] [UniProt] [MycoBrowser] [TnSeq DB] [SeqHub]

MC2-155 Coordinates:	1819676 – 1820689
Vulnerability Index (VI):
M. tuberculosis homologs	Rv3430c
M. abscessus homologs

DNA and Protein Sequence help

DNA Sequence

>ms1726_MSMEG1726_dna

GCCTGTACGACCAACGATGGTGGGGCGTACCTGCGCGGTGAGGGGTTGTCAGATCGCCGAGTGGCGCAAACAACGCGGGTGTTGGAAGGCAAGGCACCTGGGGAGAAGGTCGGTAAACTCACCCGCGAGCAGGCCGAGATCGCCCGCCTGAAAAAGGAACTCGCCCAGGCCAATAATCGGCTGGCGACCACCGAGGGGGGATCATGGGAAAAGCACACGCGCTCTTGGAGTCTCTCTCCGAGAGCGCGGACACCGACACGCCGCCGACCAAGCGCTGATGGCAACGATCTGCGGGATATCCAGCCCGCAAGGCCGCGGAGGTGACCGGCATGCACCGCTCGACGGCCACTCGACGCGCCAAACCCGCGCCGGCGCTCGGGCACCACGACCGTCAACAAGCTCACCGAGTCCGAATGCACCCGGGTGGTTGAGACAGTTCGTCGGCCGATGCAGGTGTGGGCCACGATGAAGGCAGCTACCTGTGTTCGGTGTCGACGATGTACCGCCAAGCTGGTCAAGGAGCGCCGTCGGCTGGCCCGGCACCGCAAAGCGGTGAACTGGTGGCCACCGCGCCGCGGCAGGTGTATTCGTGGGACATCACCAAACTGGCCGGCCCGGTCAAAGGGGTCTACTACGACGCCTACGTGATGATCGACATTCACTCGCGTTACATCGTCGGGGTCCATGTGCACGCCCGCGAATGCGGCCAGCTGGCCAAGGAGATGATGGAACAGATCTTCGGCACCTACGGCACGTCGTGCACGCTGATCGGGGCACCTCGATGACCAGCAACACCGTCGCCGGACGGATCTGGGCGTCATCCGCTCGCATTCGCGGCCCAAGGTATCCAACGACAACCCCTACAGCGATTCAAGACCTTGAAGTATGCGCCGGCAACGCTTCGAATCCATCCATCACGCGAGGGATTTCATGGACCGATTCGTGCAGTGGTACAACCATGAACACCGCCACAGCGGCATCGGGCTGCACACACCCGCCGATGTGGCCTCGCCGGCGGGAAAGACACCCAGCGCCGAGCCCCGACGCCAGGGCGCGCCACCCACGCCGATTCGGCCGCGACACCGCACCCAAGGTCATCGACCTACCTGAATCCGCGGCGATCAACCCACCCAAACCGGCCGAACAGGAGACCGAAACGGAAGCCGCTTAA

Protein Sequence

>Ms1726_MSMEG1726_protein

MDAYNDLRDIQIPTRKAAEVTGMHRSTATRRAKPAPAPADRAPRPVPVNKLTESECTRVVEVLNSARFVDAAPMQVWATLLDEGSYLCSVSTMYRVLNANKLVKERRRLARHRKAVCPELVATAPRQVYSWDITKLAGPVKGVYYDAYVMIDIHSRYIVGVHVHARECGQLAKEMMEQIFGTYGIPHVVHADRGTSMTSNTVAGLLSDLGVIRSHSRPKVSNDNPYSESWFKTLKYAPAFPERFESIHHARDFMDRFVQWYNHEHRHSGIGLHTPADVFYGLAGGKDTQRRAVLADARARHPRRFGRDTAPKVIDLPESAAINPPKPAEQETETEAA

Essentiality:

Call	Condition	Type	Source	Notes
Unknown	in vitro	CRISPRi	[Bosch & DeJesus et al. (2021)]
Non Essential	in vitro	TnSeq	[Dragset et al. (2019)]

You do not have permission to view notes.