Ms2290 (MSMEG2290)

Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa48e013e90>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa48e011c10>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa4467d0b30>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa4467d2030>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa485b60380>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa485b63e00>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa4436e9fa0>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa446730170>>.
Could not find gene with ID = 'MSMEG4118' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa4436e93d0>>.
Could not find gene with ID = 'MSMEG4184' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa446731940>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa446733290>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa446731ac0>>.
Could not find gene with ID = 'MSMEG2224' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa48e012e40>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa48e010f80>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa446732ab0>>.
Could not find gene with ID = 'MSMEG4107' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4379' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa494560d10>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa494562870>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa49fdfe390>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa48e7ecbf0>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa486ae5610>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa48e04a8d0>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa4436c1250>>.
Could not find gene with ID = 'MSMEG4122' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4391' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa494563ad0>>.
Could not find gene with ID = 'MSMEG2238' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4180' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4135' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa444b3c380>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa46d3adb50>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa46d3ace30>>.
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa46d3afd70>>.
Could not find gene with ID = 'MSMEG4204' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4190' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4144' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa4467e97f0>>.
Could not find gene with ID = 'MSMEG4457' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG2218' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4654' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4165' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa48e0a4d70>>.
Could not find gene with ID = 'MSMEG4287' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4349' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4377' and Strain = 'H37Rv'
Error in passages view: Field 'id' expected a number but got <SimpleLazyObject: <django.contrib.auth.models.AnonymousUser object at 0x7fa444b3f890>>.
Could not find gene with ID = 'MSMEG6666' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4398' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG0275' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4688' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4289' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4138' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4141' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4207' and Strain = 'H37Rv'
Could not find gene with ID = 'MSMEG4246' and Strain = 'H37Rv'

MSMEG2290

ms2290

M. smegmatis · MC2-155

[AlphaFold] [Orthologs] [Phyre2] [UniProt] [MycoBrowser] [TnSeq DB] [SeqHub]

MC2-155 Coordinates:	2373164 – 2373823
Vulnerability Index (VI):
M. tuberculosis homologs	Rv3058c, Rv0302
M. abscessus homologs	MAB3422c, MAB4312, MAB1217c

DNA and Protein Sequence help

DNA Sequence

>ms2290_MSMEG2290_dna

CTTGAGACCGCGGGCGGGGTGGAGAACACGAACTGCGCTTCAGCCGATGGGGATGGTGTTGGGCGTGGGCGTGAATCGGCGCCATCCAACAGATAGCGGGGAGTACTGATGGTGGTGGGCATGTATCGCGCGCGTTGCAAGTCTGTGGTGGACGTCACTTGTGACACTCATCTTGGATGTCATACTTGACGCATGTCAAGTTTTGATTTGGCGCGTCGCGGGGTTTAAACCCATGACCGCCGAATCCGTACCGCAGGGCAGCAACGCGCCACCGCCGCGCAGGCCCGTCGCTCCAGGGGCGACCGGCAACGGGAGGCCATCGTCGCCGCCGTGCGCGAAAGGAACAGCCGTTCGCGGACATCTCGGTGAGCACGATCAGTGAGCGCGCCGGTGTCGCCCGGTCGGGTTCGGTACGCGCCGTGCCGAGGCGATGGAAGAACTCGACGCGCTCACGCACAACTTCGCGCCGCGCGGTGAGAACGAGTCGCATTCGCCAAGCGCATGGTGGGCAGCGCCGCGGCGGTGTACGCCACCAACGACCCGGTCATGTCGGCCTGCACCGTCGCGCAGAACACCGACGCGCAGATCCGCGACATCATGAACGACTTCGAGGACGCCACGATCGCCAAGATCGTCGGCGTCATCGAACAGGACACCGGAGCCCGGCCGATCTCCGACGATCACTGGTGCGCACCCTGACCGCGACCACGGCGATGACACTGTCGCGTGACGCCGGGTTCGTGGGCCGTGACGCCGGCCGAGATCGTCGAACGCCTGTGGCTCAGCGCGCTGTGGGGTGGCAGTAG

Protein Sequence

>Ms2290_MSMEG2290_protein

MTAESVPQGSNGSAGATAAQARRSRGDRQREAIVAAVRELLEEQPFADISVSTISERAGVARSGFYFYFDSKYAVLAVILAEAMEELDALTHNFAPRGENESPAAFAKRMVGSAAAVYATNDPVMSACTVAQNTDAQIRDIMNDFEDATIAKIVGVIEQDTGARPISDDLPALVRTLTATTAMTLSRDAGFVGRDADPARAVEIVERLWLSALWGGLPE

Essentiality:

Call	Condition	Type	Source	Notes
Unknown	in vitro	CRISPRi	[Bosch & DeJesus et al. (2021)]
Growth Advantage	in vitro	TnSeq	[Dragset et al. (2019)]

You do not have permission to view notes.